Molecular Cloning Guide

The Big Picture: Cloning into Zymomonas

Your goal is to:

Make a plasmid and then ultimately get that plasmid into zymomonas

What does that plasmid look like?

Let’s zoom into on what smaller steps those two big steps entail:

Two approaches to cloning

GIBSON ASSEMBLY

  • PCR amplify all fragments
  • Digest vector
  • Combine everything in 1 rxn
  • 1+ inserts
  • More flexible design
  • More difficult to troubleshoot
  • Design w/ NEBuilder

TRADITIONAL CLONING

  • PCR amplify 1 fragment
  • Digest vector and fragments
  • Combine in 1 rxn. Repeat for next insert if needed.
  • 1 insert at a time
  • More limited design capability
  • Design in sequence viewer (e.g. SnapGene, Ape, CloneManager)

For both approaches, you’re going to prep a vector and insert(s) separately, then combine them.

 

Option 1: Gibson Assembly

Lots of info available on NEB’s website: https://www.neb.com/applications/cloning-and-synthetic-biology/dna-assembly-and-cloning/gibson-assembly

Gibson Assembly Reaction:

*Adjusted for molarity

To calculate amt of insert to add to the reaction:

150ng * (bp insert/bp vector) = ng insert to add

Here’s what’s happening in the tube:

 

Option 2: Traditional Cloning

Ligation Reaction:

Here’s what’s happening in the tube:

Screening for successful, correct plasmid construction

     We must ask: Did that work? Do I have the construct I want?

 

Construct Design

Start by drawing the construct you need

Remember to ask yourself:

  • Do you have appropriate markers?
  • What’s your plan for screening?
  • If you are expressing a gene from this plasmid:
    • Ribosome binding site (RBS)?
    • Promoter?
    • Start codon?
    • Stop codon?
    • Is it in-frame?
  • If you are using tags
    • N-terminal: Does your tag have a start codon? Did you remove the native start codon?
    • C-terminal: Did you remove the stop codon? Does your tag have a stop?
    • Is everything in-frame?

**If you answered “I don’t know” to any of the above… Talk to a labmate!**

Design a ribosome binding site (RBS)

  • If you are expressing a protein off your plasmid, your construct must include a RBS. Some vectors already have RBS+promoters ready-to-go, and others don’t. If you are using a vector that does not already have a RBS:
    • Go to https://www.denovodna.com/
    • Create an account with your university email
    • Follow the steps to design an appropriate RBS for your situation (pics below)
    • Remember to add this sequence into your desired final construct

Designing Gibson Cloning

  • Contact Dave if you need a SnapGene license
  • Open your vector sequence. Make sure you’ve annotated the restriction enzyme cut sites. Open all relevant fragment sequences (genes, tags, RBSs, etc)
  • Go to https://nebuilder.neb.com
    • Click “+ NEW FRAGMENT” and input your complete vector sequence
    • After pasting your sequence, click “Process text”
    • Check the “Vector” and “Circular” boxes above the Parsed Sequence box (because the sequence you just pasted is your vector for cloning, and it’s a circular piece of DNA – not linear)
    • Name the fragment
    • Choose the method you will use to linearize the plasmid. You have two real options:
      • PCR: Amplify a portion of the plasmid using PCR, which creates linear pieces of DNA. If you don’t want to use the whole plasmid, you can amplify only the desired fragment.
      • Restriction digest: Cut open the plasmid with a restriction enzyme. You only need to cut the plasmid one time, to linearize it. If you want to use only a portion of the plasmid, you may cut multiple times to isolate your desired fragment.
      • If you are buying a synthesized vector (which is very unlikely, unless you are doing something really new and you happen to have a ginormous cloning budget…), check that box.
    • Add the sequences of your insert fragments using the “+ NEW FRAGMENT” button. Uncheck the Vector and Circular boxes (unless you are, in fact, using a circular DNA sequence as an insert; then you’ll have to choose a linearization method for that as well). Drag the fragments to get them in the right order. Make sure you input all genes in the correct orientation that you want for your final construct.

  • NEBuilder will output primers for you under “Required Oligonucleotides”
    • These are program suggestions – use your brain, too! Make sure these amplify what you want to amplify, are reasonable lengths, GC content, etc.
    • If you have any wiggle room on insert sequence, play with it to make optimal matching pairs of primers.
    • Everything is color coded to match it’s origin sequence
    • Primers are given as 5’-(overlap/spacer/ANNEAL)-3’. This means:
      • Sequence is written 5’ to 3’
      • 1st color = sequence acting as the adapter, creating overlap to the fragment of that color
      • 2nd color = sequence acting as a spacer (only present if you added a spacer)
      • 3rd color = sequence that this primer anneals to (and amplifies). Note that primers with the same ANNEAL color are primer pairs.
    • Validate your primers with IDT’s OligoAnalyzer
      • https://www.idtdna.com/calc/analyzer
      • Login (No ordering on this account)
      • Ideal primers have:
        • 40-60% GC content
        • Low favorability for hairpin formation, dimerization (i.e. high ΔG)
        • Primer pairs have similar melt temps
      • Order your primers
        • Create excel document with primer names and sequences
Name Sequence
mygene_F1 AGTCGATGACTCGAG
mygene_R1 GCGTACATGCATCGA
taggymctaggerson_F1 CGCTAGCTAGCTACA
taggymctaggerson_R1 CGATCGTAGCTAGCT
  • Record that you have a primer order in the ordering sheet on the lab website
  • Email/Teams your excel list of primers to Dave at dmstevenson@wisc.edu

Designing Traditional Cloning

  • Contact Dave if you need a SnapGene license
  • Open your vector sequence. Make sure you’ve annotated the restriction enzyme cut sites. Open your fragment sequence
  • Linearize your plasmid
    • Choose a pair of restriction enzymes (w/ compatible buffers) that will cut your plasmid to open the space in which you want to insert a fragment. Compatibility chart available here: https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes
    • Using two enzymes that leave different overhangs allows you to control which direction your fragment anneals into the open vector. If you only cut the plasmid once, the overhangs will be identical and your insert can anneal in either orientation, meaning you must do an additional screening step.
  • Identify the insert sequence you wish to add. You will need to design an upstream and downstream primer to amplify this sequence. Starting at the 5’ end and working with the sequence in the forward direction, choose ~14-20 bases at the start of this insert sequence.
    • If you have wiggle room about where your sequence starts, use the OligoAnalyzer (see Gibson section) to find a space with ideal primer characteristics:
      • 40-60% GC content
      • Low favorability for hairpin formation, dimerization (i.e. high ΔG)
      • Primer pairs have similar melt temps
    • Once you’re happy with this sequence choice, add the restriction enzyme recognition site to the 5’ end of the primer sequence.
    • Then, add an extra 4 bases, again at the 5’ end. This little tail can be any sequence – use it to balance GC content if needed. It’s purpose is to give the restriction enzyme some extra physical space to sit down on (since they are endonucleases), so the sequence is irrelevant. Your final primer will look like:
      • ACTGAGATCTTGACTGACCATCGATC
      • Where black is the 4bp tail, blue is the cut site, and red is the sequence of your fragment where the primer will bind and begin to amplify.
    • Repeat this process to design your reverse primer. I recommend setting your insert sequence to the reverse complement in SnapGene, and then acting in the “forward” direction while you design the primer, so that everything is consistently going in the correct direction.